View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17837_high_33 (Length: 350)

Name: NF17837_high_33
Description: NF17837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17837_high_33
NF17837_high_33
[»] chr4 (1 HSPs)
chr4 (242-333)||(7707229-7707321)


Alignment Details
Target: chr4 (Bit Score: 85; Significance: 2e-40; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 242 - 333
Target Start/End: Complemental strand, 7707321 - 7707229
Alignment:
Q  242 gagcatgaagtttgtctcttaattctttttcttgaaaatggttgat-atataagagaaaatttgagagatttgattgtagaatatgcaggatt 333  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
T  7707321 gagcatgaagtttgtctcttaattctttttcttgaaaatggttgattatataagagaaaatttgagagatttgattgtagaatatgcaggatt 7707229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University