View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17836_low_40 (Length: 314)

Name: NF17836_low_40
Description: NF17836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17836_low_40
NF17836_low_40
[»] chr7 (1 HSPs)
chr7 (10-314)||(48649665-48649969)
[»] chr3 (1 HSPs)
chr3 (144-194)||(43156156-43156206)
[»] chr8 (2 HSPs)
chr8 (144-194)||(20286291-20286341)
chr8 (144-194)||(21072920-21072970)


Alignment Details
Target: chr7 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 10 - 314
Target Start/End: Original strand, 48649665 - 48649969
Alignment:
Q  10 catcatcattcatcaaattccttctttcttatagactgactagttagtattaattagtagcagccgggtgaaccaactgatatttagagagatcaatcaa 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48649665 catcatcattcatcaaattccttctttcttatagactgactagttagtattaattagtagcagccgggtgaaccaactgatatttagagagatcaatcaa 48649764  T
Q  110 ttagattgatgatgggcagcaacaatggatcaccatcacagtttggggacacaacgctgacaaaagtgttcgttggaggtcttgcctgggaaactccgaa 209  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48649765 atagattgatgatgggcagcaacaatggatcaccatcacagtttggggacacaacgctgacaaaagtgttcgttggaggtcttgcctgggaaactccgaa 48649864  T
Q  210 agacacattaagagaacacttcgaaaaatacggagacatccttgaagctgtcataatttctgataaggttaccggcagatccaaagggtatggatttgta 309  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48649865 agacacattaagagaacacttcgaaaaatacggagacatccttgaagctgtcataatttctgataaggttaccggcagatccaaagggtatggatttgta 48649964  T
Q  310 acatt 314  Q
    |||||    
T  48649965 acatt 48649969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 144 - 194
Target Start/End: Complemental strand, 43156206 - 43156156
Alignment:
Q  144 atcacagtttggggacacaacgctgacaaaagtgttcgttggaggtcttgc 194  Q
    ||||||||||||||| ||||||||||| ||||| |||||||||||||||||    
T  43156206 atcacagtttggggatacaacgctgactaaagtattcgttggaggtcttgc 43156156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 144 - 194
Target Start/End: Complemental strand, 20286341 - 20286291
Alignment:
Q  144 atcacagtttggggacacaacgctgacaaaagtgttcgttggaggtcttgc 194  Q
    |||| |||||||||| ||||||||||| ||||| || ||||||||||||||    
T  20286341 atcatagtttggggatacaacgctgactaaagtatttgttggaggtcttgc 20286291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 144 - 194
Target Start/End: Complemental strand, 21072970 - 21072920
Alignment:
Q  144 atcacagtttggggacacaacgctgacaaaagtgttcgttggaggtcttgc 194  Q
    |||| |||||||||| ||||||||||| ||||| || ||||||||||||||    
T  21072970 atcatagtttggggatacaacgctgactaaagtatttgttggaggtcttgc 21072920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University