View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17834_high_8 (Length: 230)

Name: NF17834_high_8
Description: NF17834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17834_high_8
NF17834_high_8
[»] chr8 (1 HSPs)
chr8 (38-198)||(10572222-10572382)


Alignment Details
Target: chr8 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 38 - 198
Target Start/End: Complemental strand, 10572382 - 10572222
Alignment:
Q  38 ctaaaagataatcaggtctaccataaagcccaagagaagcccattcaggattgaaccatatgatgaataaattatctaaacttatcctgaaaataaattt 137  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  10572382 ctaaaagataatcaggtctaccataaagcccaagagaagcccattcaggattgaaccatatgatgaataaattatctaaacttatcctgaaaataaattt 10572283  T
Q  138 gaatttcataacgattcccggtataannnnnnnnaaacatgcaccaaattatatctcacca 198  Q
    ||||||||||||||||||||||||||        |||||||||||||||||||||||||||    
T  10572282 gaatttcataacgattcccggtataattttttttaaacatgcaccaaattatatctcacca 10572222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University