View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17832_low_3 (Length: 255)

Name: NF17832_low_3
Description: NF17832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17832_low_3
NF17832_low_3
[»] chr8 (2 HSPs)
chr8 (19-219)||(28415842-28416039)
chr8 (205-255)||(1839658-1839708)
[»] chr3 (1 HSPs)
chr3 (187-255)||(53888679-53888746)


Alignment Details
Target: chr8 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 19 - 219
Target Start/End: Original strand, 28415842 - 28416039
Alignment:
Q  19 ggtaggaacattttgttatgcaagagtcaaagttgaaactatggattcctcacttcataaccttacatgatgaatttatagctaccgagactatttgaca 118  Q
    |||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
T  28415842 ggtaggaacattgtgttgtgcaagagtcaaagttgaaactatggattcctcacttcataaccttacatgatgaatttatagccaccgagactatttgaca 28415941  T
Q  119 aaaacatagtactaagacattttctatatataaactagtacnnnnnnnnnnnngacaagtagcctagactttgttttggagtttttgaggggaatggaag 218  Q
    ||||||||||| |||| ||||||||||||||||||||||||            | ||||||||| ||||||||||| |||||||||||||||||||||||    
T  28415942 aaaacatagtattaaggcattttctatatataaactagtac---tttttttatgtcaagtagcccagactttgtttcggagtttttgaggggaatggaag 28416038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 205 - 255
Target Start/End: Original strand, 1839658 - 1839708
Alignment:
Q  205 gaggggaatggaaggaaaggttttgggaggacaaaaatatagagaaaaatt 255  Q
    |||||||| ||||||||||| |||||| |||||||| ||||||| ||||||    
T  1839658 gaggggaagggaaggaaaggctttggggggacaaaattatagaggaaaatt 1839708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 187 - 255
Target Start/End: Complemental strand, 53888746 - 53888679
Alignment:
Q  187 ctttgttttggagtttttgaggggaatggaaggaaaggttttgggaggacaaaaatatagagaaaaatt 255  Q
    |||||||| |||||||  |||||||  ||||||||||| |||||| |||||||||||||| | ||||||    
T  53888746 ctttgtttgggagtttg-gaggggaggggaaggaaaggctttgggtggacaaaaatataggggaaaatt 53888679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University