View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17828_low_48 (Length: 238)

Name: NF17828_low_48
Description: NF17828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17828_low_48
NF17828_low_48
[»] chr3 (1 HSPs)
chr3 (36-238)||(50420905-50421112)


Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 36 - 238
Target Start/End: Complemental strand, 50421112 - 50420905
Alignment:
Q  36 ctcaagtctagtgattgattacgtgggtatcagagatctcaaaccgagtcaaaactt-----gacaacacaatgatgcttgaaactcacgcaccacattc 130  Q
    |||| ||||||||| ||||||||||||||||| ||||||||||||||||||||||||     ||||||||||||||||||||||||||||||||||||||    
T  50421112 ctcaggtctagtgactgattacgtgggtatcaaagatctcaaaccgagtcaaaacttaataggacaacacaatgatgcttgaaactcacgcaccacattc 50421013  T
Q  131 atactaaacacaagacggtgaaagaggaattacgtttgcgggggagctgtgtatccaagaccttgtcaaaatttaaaggcttaatagcaattttggcctc 230  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| ||||||||||    
T  50421012 atactaaacacaagacggtgaaagaggaattacgtttgcgggggagctgtgtaccgaagaccttgtcaaaatttaaaggcttaatagcagttttggcctc 50420913  T
Q  231 ctgagtat 238  Q
    || |||||    
T  50420912 ctaagtat 50420905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University