View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17828_low_21 (Length: 332)

Name: NF17828_low_21
Description: NF17828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17828_low_21
NF17828_low_21
[»] chr7 (2 HSPs)
chr7 (108-322)||(45783079-45783280)
chr7 (53-84)||(45783021-45783052)


Alignment Details
Target: chr7 (Bit Score: 146; Significance: 7e-77; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 108 - 322
Target Start/End: Original strand, 45783079 - 45783280
Alignment:
Q  108 tagtgtattgaatgtaacgggattggaggtggtgaattttgtagtttagtgattgattttgtgcgtgcttatcccacttgtcttcatttcctaaactata 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  45783079 tagtgtattgaatgtaacgggattggaggtggtgaattttgtagtttagtgattgatattgtgcgtgcttatcccacttgtcttcatttcctaaactata 45783178  T
Q  208 gcatagccttttcatttccactcagctcaacacacacacgctctcactcactccctttctcttattattagtatagtattaaccatcatcctcatccctt 307  Q
    ||||||||||||||||||||||||||||||||||        | ||||||||| ||||||||||||||     || ||||||||||||||||||||||||    
T  45783179 gcatagccttttcatttccactcagctcaacaca--------cgcactcactctctttctcttattat-----tattattaaccatcatcctcatccctt 45783265  T
Q  308 tcagatctccctctc 322  Q
    ||||||||| |||||    
T  45783266 tcagatctctctctc 45783280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 53 - 84
Target Start/End: Original strand, 45783021 - 45783052
Alignment:
Q  53 cgtaacaagttgttatatttaattagaaccca 84  Q
    ||||||||||||||||||||||||||||||||    
T  45783021 cgtaacaagttgttatatttaattagaaccca 45783052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University