View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17817_low_30 (Length: 245)

Name: NF17817_low_30
Description: NF17817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17817_low_30
NF17817_low_30
[»] chr8 (1 HSPs)
chr8 (12-151)||(44540679-44540818)


Alignment Details
Target: chr8 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 12 - 151
Target Start/End: Original strand, 44540679 - 44540818
Alignment:
Q  12 atggggtttgcaaaatgaaacaaaattggcactataaaatctcaacatagtatagatctgaaaggaatggaatcatttttaccgtttgataaaagggttt 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
T  44540679 atggggtttgcaaaatgaaacaaaattggcactataaaatctcaacatagtatagatctgaaaggaatggaatcattttcaccgtttgataaaagggttt 44540778  T
Q  112 atttttagtttaaggaaagtgggtcataattaaatgaagt 151  Q
    |||||||||||||||||||||| |||||||||||||||||    
T  44540779 atttttagtttaaggaaagtggatcataattaaatgaagt 44540818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University