View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17814_low_39 (Length: 236)

Name: NF17814_low_39
Description: NF17814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17814_low_39
NF17814_low_39
[»] chr2 (2 HSPs)
chr2 (7-112)||(33433259-33433364)
chr2 (136-206)||(33433583-33433657)


Alignment Details
Target: chr2 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 7 - 112
Target Start/End: Original strand, 33433259 - 33433364
Alignment:
Q  7 ttgtgtgatgcatgtaaatgtgagtaatgctttcttggggatggtgaatatgtttcttgaactattgaattgtgggattggtgtcaatgtgaataacact 106  Q
    ||||||||||  |||||||||||||||  |||||||||||| ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||    
T  33433259 ttgtgtgatgggtgtaaatgtgagtaacactttcttggggagggtgaatatgtttcttgaactattgaattatgtgattggtgtcaatgtgaataacact 33433358  T
Q  107 ttcttg 112  Q
    ||||||    
T  33433359 ttcttg 33433364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 136 - 206
Target Start/End: Original strand, 33433583 - 33433657
Alignment:
Q  136 tttgggtctcttcccttcagata----ccttgatccttctggttaacaaggtcagtctcttaaaggaactaacct 206  Q
    ||||||||||||||||| |||||    ||||||||||||||||||| ||||||| |||||||| |||||| ||||    
T  33433583 tttgggtctcttccctttagatatataccttgatccttctggttaataaggtcaatctcttaagggaactgacct 33433657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University