View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17814_low_24 (Length: 340)

Name: NF17814_low_24
Description: NF17814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17814_low_24
NF17814_low_24
[»] chr4 (3 HSPs)
chr4 (31-233)||(7909921-7910123)
chr4 (31-91)||(7792985-7793045)
chr4 (34-77)||(8514188-8514231)


Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 31 - 233
Target Start/End: Complemental strand, 7910123 - 7909921
Alignment:
Q  31 ttgatggttgtgtggacacaaatctcttttgcatctctaacagtctgccctgtaatgtgaaattgtgaatatcaatgtggttgcaactaatatatgacat 130  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7910123 ttgatggttgtgtggacacaaatctcttttgcatctctaacagtctgccctgtaatgtgaaattgtgaatatcaatgtggttgcaactaatatatgacat 7910024  T
Q  131 agtgtcaaaagcactgtcaaatgataaggtattatttgaaagcaattatcaatgaaactgagatatgttattgaaagtcaccaacaaaagcactttctgc 230  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  7910023 agtgtcaaaagcactgtcaaataataaggtattatttgaaagcaattatcaatgaaactgagatatgttattgaaagtcaacaacaaaagcactttctgc 7909924  T
Q  231 atc 233  Q
    |||    
T  7909923 atc 7909921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 31 - 91
Target Start/End: Original strand, 7792985 - 7793045
Alignment:
Q  31 ttgatggttgtgtggacacaaatctcttttgcatctctaacagtctgccctgtaatgtgaa 91  Q
    |||||||||||||||| ||||||||||| ||||| ||||||| ||| || |||||||||||    
T  7792985 ttgatggttgtgtggagacaaatctcttctgcatatctaacattctaccttgtaatgtgaa 7793045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 34 - 77
Target Start/End: Original strand, 8514188 - 8514231
Alignment:
Q  34 atggttgtgtggacacaaatctcttttgcatctctaacagtctg 77  Q
    ||||||||||||| ||||||||||||||||||||||| ||||||    
T  8514188 atggttgtgtggagacaaatctcttttgcatctctaaaagtctg 8514231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University