View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17811_low_43 (Length: 286)

Name: NF17811_low_43
Description: NF17811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17811_low_43
NF17811_low_43
[»] chr4 (1 HSPs)
chr4 (1-272)||(36502159-36502430)


Alignment Details
Target: chr4 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 272
Target Start/End: Complemental strand, 36502430 - 36502159
Alignment:
Q  1 agtttctgtgcatgtctatgcatattcgatttcccatataacgtaatcaaacgtgccgagaaaccctcatttgatatatcagcgtaactcttctgatgct 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36502430 agtttctgtgcatgtctatgcatattcgatttcccatataacgtaatcaaacgtgccgagaaaccctcatttgatatatcagcgtaactcttctgatgct 36502331  T
Q  101 cgataatgtcgcggacccaccggaagcgtttagctccggcgaggcggcggacggtgtcttcatagatgccgnnnnnnnnacggaaacgatcaatgtctga 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||    
T  36502330 cgataatgtcgcggacccaccggaagcgtttagctccggcgaggcggcggacggtgtcttcatagatgccgttttttttacggaaacgatcaatgtctga 36502231  T
Q  201 agcttttttgaatttttcaacgagtgttttgagattttgttcttggtataggtcttgtgaaatggatttgat 272  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
T  36502230 agcttttttgaatttttcaacgagtgttttgagattttgttctttgtataggtcttgtgaaatggatttgat 36502159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University