View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17811_high_56 (Length: 240)

Name: NF17811_high_56
Description: NF17811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17811_high_56
NF17811_high_56
[»] chr4 (1 HSPs)
chr4 (16-223)||(32236025-32236221)


Alignment Details
Target: chr4 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 16 - 223
Target Start/End: Original strand, 32236025 - 32236221
Alignment:
Q  16 atgagtcacggaacttaattatgtgtaggtgttgaatgtttaatttcaatgttgtgcattcttttctttggggaggatccatactacttatgttttatgg 115  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||       |||||     
T  32236025 atgagtcacggaacttaattatgtgtaggtgttgaatgtgtaatttcaatgttgtgcattcttttctttggggaggatccatactac-------ttatga 32236117  T
Q  116 tattattggttggtgtgtcaagtatgagttaaatattctacatattagaaagnnnnnnnngtaaatgtgaaaaatatttggttaaatatttttgacccat 215  Q
    ||  ||||||||| |||||||||||||||||||||||||  |||||||||||        ||||||||| ||||||||||||||||||||||||||||||    
T  32236118 taggattggttggcgtgtcaagtatgagttaaatattct--atattagaaag-aaaaaaagtaaatgtg-aaaatatttggttaaatatttttgacccat 32236213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University