View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1780_low_54 (Length: 209)

Name: NF1780_low_54
Description: NF1780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1780_low_54
NF1780_low_54
[»] chr8 (2 HSPs)
chr8 (17-89)||(38380822-38380894)
chr8 (141-187)||(38380941-38380988)


Alignment Details
Target: chr8 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 17 - 89
Target Start/End: Original strand, 38380822 - 38380894
Alignment:
Q  17 cacagattataaattcaaaaaataaaataacgaaagaaaggaagcgaacgaacctgggagcggaagcttcggt 89  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
T  38380822 cacagattataaattcaaaaaataaaataacgaaagaaacgaagcgaacgaacctgggagcggaagcttcggt 38380894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 141 - 187
Target Start/End: Original strand, 38380941 - 38380988
Alignment:
Q  141 cgctcttgatctttt-gtccttcccgctaatggagagggacatgtggg 187  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||    
T  38380941 cgctcttgatctttttgtccttcccgctaatggagagggacatgtggg 38380988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University