View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1780_low_52 (Length: 213)

Name: NF1780_low_52
Description: NF1780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1780_low_52
NF1780_low_52
[»] chr5 (1 HSPs)
chr5 (20-198)||(38000351-38000529)


Alignment Details
Target: chr5 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 20 - 198
Target Start/End: Complemental strand, 38000529 - 38000351
Alignment:
Q  20 aggcatccaatacaaatatcatggaatgatggagtgaatggcgaggagcatggtaattgaatgagatttagttaatcaatgattgtcttgactcttgagg 119  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38000529 aggcaaccaatacaaatatcatggaatgatggagtgaatggcgaggagcatggtaattgaatgagatttagttaatcaatgattgtcttgactcttgagg 38000430  T
Q  120 catggtgagagagaaggaaaatttggtcgattgaagaaaatgtgtcttaattgagagaagggaaattgtggaagaaaat 198  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38000429 catggtgagagagaaggaaaatttggtagattgaagaaaatgtgtcttaattgagagaagggaaattgtggaagaaaat 38000351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University