View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17808_high_9 (Length: 242)

Name: NF17808_high_9
Description: NF17808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17808_high_9
NF17808_high_9
[»] chr4 (1 HSPs)
chr4 (14-137)||(38712112-38712235)


Alignment Details
Target: chr4 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 14 - 137
Target Start/End: Complemental strand, 38712235 - 38712112
Alignment:
Q  14 ttcttctgtctttctacttcaagtttggaaagccttacttcccccaactctagtttttatttttaggacatgtgcatggttccaatataacattaaccaa 113  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38712235 ttcttctgtctttctacttcaagtttggaaagccctacttcccccaactctagtttttatttttaggacatgtgcatggttccaatataacattaaccaa 38712136  T
Q  114 aactttatcccatatcaaatatgg 137  Q
    ||||||||||||||||||||||||    
T  38712135 aactttatcccatatcaaatatgg 38712112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University