View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17806_low_7 (Length: 207)

Name: NF17806_low_7
Description: NF17806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17806_low_7
NF17806_low_7
[»] chr4 (1 HSPs)
chr4 (86-191)||(43394006-43394113)


Alignment Details
Target: chr4 (Bit Score: 89; Significance: 4e-43; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 86 - 191
Target Start/End: Complemental strand, 43394113 - 43394006
Alignment:
Q  86 agccatcacccaagtaataatatgatggaattgcaaatgggt--gttatattttctattactactgtcggaacttgctgcaaatgaactacaacggtatg 183  Q
    ||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||    
T  43394113 agccatcacccaagtaataatatgatggaattgcaaatgggtttgttatattttctattactactgttggaacttgctgcaaatgaactgcaacggtatg 43394014  T
Q  184 gagccttt 191  Q
    ||||||||    
T  43394013 gagccttt 43394006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University