View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1779_low_7 (Length: 241)

Name: NF1779_low_7
Description: NF1779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1779_low_7
NF1779_low_7
[»] chr2 (2 HSPs)
chr2 (109-204)||(41997479-41997574)
chr2 (16-77)||(41997574-41997635)


Alignment Details
Target: chr2 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 109 - 204
Target Start/End: Complemental strand, 41997574 - 41997479
Alignment:
Q  109 gatttacgtttcatctaaagctaaggttatagtttgggtattacttaaaggaagaatagcaactagagacatttgctcaaaagaggggtaatgtcc 204  Q
    |||||| ||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41997574 gatttatgtttcatctaaagctaaggttatagtttgaggattacttaaaggaagaatagcaactagagacatttgctcaaaagaggggtaatgtcc 41997479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 16 - 77
Target Start/End: Complemental strand, 41997635 - 41997574
Alignment:
Q  16 caagttcttgttttaaacatttggtctaacatataaatacaaatgttcaatctattgatatg 77  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||    
T  41997635 caagttcttgttttaaacatttggtctcacatataaatacaaatgttcaatctagtgatatg 41997574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University