View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17797_low_52 (Length: 211)

Name: NF17797_low_52
Description: NF17797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17797_low_52
NF17797_low_52
[»] chr7 (1 HSPs)
chr7 (1-99)||(40953803-40953904)


Alignment Details
Target: chr7 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 99
Target Start/End: Original strand, 40953803 - 40953904
Alignment:
Q  1 acccgactcttaacctgataaaatttggtcagacgttacaaagacaaccgattgatcccaagaagagccgacaaa---tagtaatacataaagttatttt 97  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   ||||||||||||||||||||||    
T  40953803 acccgactcttaacctgataaaatttggtcagacgttacaaagacaaccgattgatcccaagaagagccgacaaatagtagtaatacataaagttatttt 40953902  T
Q  98 at 99  Q
    ||    
T  40953903 at 40953904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University