View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17795_low_58 (Length: 238)

Name: NF17795_low_58
Description: NF17795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17795_low_58
NF17795_low_58
[»] chr5 (1 HSPs)
chr5 (18-238)||(5665147-5665367)


Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 5665367 - 5665147
Alignment:
Q  18 atataaggggcatataattgtataaaatgaattataacaacatgccatgacataatatgtgaaagaataaatgaaattccctttctaccaaaaacctaga 117  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
T  5665367 atataaggggcatataattgtataaaatgaattatagcaacatgccatgacataatatgtgaaagaataaatgaaattctctttctaccaaaaacctaga 5665268  T
Q  118 tagaaaagtagaaatctccatcattgtccagtatatagtttcatttctagattataacttactttagaacaatgttgtatttggttaacggttgtgcagn 217  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||     
T  5665267 tagaaaagtagaaatctcaatcattgtccagtatatagtttcatttctagattataacttactttagaacaatgttttatttggttaacggttgtgcaga 5665168  T
Q  218 nnnnnntgcataaaaaatgtt 238  Q
          |||||||||||||||    
T  5665167 aaaaaatgcataaaaaatgtt 5665147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University