View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17793_high_29 (Length: 426)

Name: NF17793_high_29
Description: NF17793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17793_high_29
NF17793_high_29
[»] chr2 (1 HSPs)
chr2 (14-53)||(36865425-36865464)


Alignment Details
Target: chr2 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 14 - 53
Target Start/End: Complemental strand, 36865464 - 36865425
Alignment:
Q  14 atattttttattgaatgatgtatcacatacatatatattg 53  Q
    ||||||||||||||||||||||||||||||||||||||||    
T  36865464 atattttttattgaatgatgtatcacatacatatatattg 36865425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University