View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17791_high_21 (Length: 233)

Name: NF17791_high_21
Description: NF17791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17791_high_21
NF17791_high_21
[»] chr3 (1 HSPs)
chr3 (1-214)||(51995686-51995893)


Alignment Details
Target: chr3 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 51995893 - 51995686
Alignment:
Q  1 tagactaccaggacaccactatggtgcaacactggatgaataatatgtaccattgaaagtggacgctttctttgtcgggataaaatnnnnnnnnnncaca 100  Q
    ||||||||||| ||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| |          ||||    
T  51995893 tagactaccagtacaccactatggtgcaaaacttgatgaataatatgtaccattgaaagtggacgctttctttgtcgggataaattaaaaaaaa--caca 51995796  T
Q  101 acagtatgaaaaaatgtctaaagataattagtattgtatttcaggtcagataatgaatccttctttttaaagtcatgaaaaaacaaatttatttattact 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    |||||||    
T  51995795 acagtatgaaaaaatgtctaaagataattagtattgtatttcaggtcagataatgaatccttctttttaaagtcatgaaaaaacaaatt----tattact 51995700  T
Q  201 ttattgatggacat 214  Q
    ||||||||||||||    
T  51995699 ttattgatggacat 51995686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University