View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17788_low_10 (Length: 216)

Name: NF17788_low_10
Description: NF17788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17788_low_10
NF17788_low_10
[»] chr2 (1 HSPs)
chr2 (33-199)||(22041193-22041357)


Alignment Details
Target: chr2 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 33 - 199
Target Start/End: Complemental strand, 22041357 - 22041193
Alignment:
Q  33 aaacacaatcaaacaaattagagcaacacggtaactaatttcaatcacttaagcggtagcaacaaattagagaagnnnnnnnnnnntgaaactctagaga 132  Q
    |||||| || || |||||||||||||||||| |||||||||||||||||||||  ||||||||||||||||||||           ||||||||||||||    
T  22041357 aaacacgatgaatcaaattagagcaacacggcaactaatttcaatcacttaagtagtagcaacaaattagagaagaaaaaaaat--tgaaactctagaga 22041260  T
Q  133 agtggaatggaaaatccataagaaaactgcacatttatttatgttaattaaagaacttacttgtttg 199  Q
    ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  22041259 agttgaatggaaaatccataagaaaactgcacatttatttatgttaattaaagaacttacttgtttg 22041193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University