View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17786_high_8 (Length: 303)

Name: NF17786_high_8
Description: NF17786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17786_high_8
NF17786_high_8
[»] chr3 (2 HSPs)
chr3 (13-111)||(48673729-48673826)
chr3 (176-285)||(48673885-48673994)


Alignment Details
Target: chr3 (Bit Score: 87; Significance: 1e-41; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 13 - 111
Target Start/End: Original strand, 48673729 - 48673826
Alignment:
Q  13 aaaatgtgacaactgcgtttaaaattgcagatatgatgtcattgcagagccttttaaaacccgtaatattgagtccgcaattacgattgtagatcacaa 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||    
T  48673729 aaaatgtgacaactgcgtttaaaattgcagatatgatgtcattgcagagcc-tttaaaacccgtaatattgagtccgcaattatgattgtagatcacaa 48673826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 176 - 285
Target Start/End: Original strand, 48673885 - 48673994
Alignment:
Q  176 ccttatcaactgagttaaactcacgtggatatatgacaatttaaaactatgattatcaccacgcacataaaatatcatcttaaattatgagtcatactca 275  Q
    ||||| ||||||||||||||||||||| | | ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||    
T  48673885 ccttaccaactgagttaaactcacgtgaacagatgacaatttaaaactatgattatcactacgcacataaaatatcatcttaaattatgagtcacactca 48673984  T
Q  276 atcgtgcaaa 285  Q
    ||| ||||||    
T  48673985 atcctgcaaa 48673994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University