View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17785_high_11 (Length: 236)

Name: NF17785_high_11
Description: NF17785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17785_high_11
NF17785_high_11
[»] chr7 (1 HSPs)
chr7 (1-222)||(9569437-9569654)


Alignment Details
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 9569437 - 9569654
Alignment:
Q  1 aaggatattgtaacccttgaatataaaattcttcaatatcagggttggaataagtgttttaaggtgtttatttgggttcagttaattgtgggaagagaat 100  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||    |||||||||||||||    
T  9569437 aaggatattgtaacccttgaatataaaattcttcaatattagggttggaataagtgttttcaggtgtttatttgggttcag----ttgtgggaagagaat 9569532  T
Q  101 gtgtgctggcagagggttttgatggnnnnnnnnnnnnnnnnngtacgagtagcggacgataggtgtttagaacttgttttggtagccatcaactagttgg 200  Q
    |||||||||||||||||||||||||                 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9569533 gtgtgctggcagagggttttgatggttttttggagttttttggtacgagtagcggacgataggtgtttagaacttgttttggtagccatcaactagttgg 9569632  T
Q  201 gtagtgtatttagtggtgtttt 222  Q
    || |||||||||||||||||||    
T  9569633 gtggtgtatttagtggtgtttt 9569654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University