View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17784_high_12 (Length: 251)

Name: NF17784_high_12
Description: NF17784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17784_high_12
NF17784_high_12
[»] chr1 (2 HSPs)
chr1 (1-84)||(14367765-14367848)
chr1 (188-234)||(14367952-14367998)


Alignment Details
Target: chr1 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 14367765 - 14367848
Alignment:
Q  1 tgtttgctaaagttaatttaagcataagtcggcagaaagatagttcacttttattattcagtaattaaaagaggtcaaatatca 84  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  14367765 tgtttgctaaagttaatttaagcataagtcggcagaaagatagttcacttttattattcagtaattaaaagaggtcaaatatca 14367848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 188 - 234
Target Start/End: Original strand, 14367952 - 14367998
Alignment:
Q  188 gttggtaaattaatatctctctgtcccactatagtagtacaacaatt 234  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
T  14367952 gttggtaaattaatatctctctgtcccactatagtagtacaacaatt 14367998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University