View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17781_high_16 (Length: 241)

Name: NF17781_high_16
Description: NF17781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17781_high_16
NF17781_high_16
[»] chr4 (1 HSPs)
chr4 (82-241)||(43214003-43214162)


Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 82 - 241
Target Start/End: Original strand, 43214003 - 43214162
Alignment:
Q  82 aaagtaaatgatgaaattactctactaagccgatgacactctcagtactactacataatttagtatcttgcaataaatgaaatgtttatggcattattta 181  Q
    |||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43214003 aaagtaaatgatcaaattactctgctaagccgatgacactctcagtactactacataatttagtatcttgcaataaatgaaatgtttatggcattattta 43214102  T
Q  182 caagtagtttaataattttggttgtataactgtaaatgaaatgtaatgttgcaaataaat 241  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43214103 caagtagtttaataattttggttgtataactgtaaatgaaatgtaatgttgcaaataaat 43214162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University