View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17778_high_12 (Length: 243)

Name: NF17778_high_12
Description: NF17778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17778_high_12
NF17778_high_12
[»] chr3 (1 HSPs)
chr3 (123-234)||(39053587-39053698)


Alignment Details
Target: chr3 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 123 - 234
Target Start/End: Original strand, 39053587 - 39053698
Alignment:
Q  123 gtttaaaatttgaagatgaagaatatgaaccgtttagtcatacgtaaatcttttgggataatggatgtacgtatgtgtagaagnnnnnnntgaatggtta 222  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||       ||||||||||    
T  39053587 gtttaaaatttgaagatcaagaatatgaaccgtttagtcatacgtaaatcttttgggataatggatgtacgtatgtgttgaagaaaaaaatgaatggtta 39053686  T
Q  223 caacagaattat 234  Q
    ||||||||||||    
T  39053687 caacagaattat 39053698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University