View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17777_low_39 (Length: 249)

Name: NF17777_low_39
Description: NF17777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17777_low_39
NF17777_low_39
[»] chr3 (1 HSPs)
chr3 (12-131)||(20372532-20372651)


Alignment Details
Target: chr3 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 12 - 131
Target Start/End: Complemental strand, 20372651 - 20372532
Alignment:
Q  12 aaaattaattaaaatcgtcttatttagtttcaagaaaaatgttgattgtttgagaaattagatgatagacattgtagtaaaccatttaaccttttggaac 111  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| || |||||||||||||||||||||||    
T  20372651 aaaattaattaaaatcgtcttatttagtttcaagaaaaatgttgattgattgagaaattagatgatagacattataataaaccatttaaccttttggaac 20372552  T
Q  112 acttataaataagtgaagaa 131  Q
    ||||||||||||||||||||    
T  20372551 acttataaataagtgaagaa 20372532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University