View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17775_low_36 (Length: 219)

Name: NF17775_low_36
Description: NF17775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17775_low_36
NF17775_low_36
[»] chr2 (1 HSPs)
chr2 (1-207)||(13367665-13367871)


Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 13367871 - 13367665
Alignment:
Q  1 tcttcaccatatcatcctatgatagcacaacatggtgcaccgagagtagtgttactttgtccacctgggtcaccatgggagacacaaccttatgaagagg 100  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  13367871 tcttcaccatatcatcctatgatagcacaacatggtgcaccaagagtagtgttactttgtccacctgggtcaccatgggagacacaaccttatgaagagg 13367772  T
Q  101 gtcctaatgaggttcattttgatccagccacatccagaaataatggagcttccatgcaagtagacaataatattattgatggtgatgttgatcttaattt 200  Q
    ||||||||||||||||||||||| |||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  13367771 gtcctaatgaggttcattttgatgcagctacatccagaaataatggggcttccatgcaagtagacaataatattattgatggtgatgttgatcttaattt 13367672  T
Q  201 gagccta 207  Q
    |||||||    
T  13367671 gagccta 13367665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University