View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17774_low_10 (Length: 207)

Name: NF17774_low_10
Description: NF17774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17774_low_10
NF17774_low_10
[»] chr3 (1 HSPs)
chr3 (12-191)||(36576354-36576533)


Alignment Details
Target: chr3 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 12 - 191
Target Start/End: Original strand, 36576354 - 36576533
Alignment:
Q  12 gcagtaatcccatgtcacctgttatcaaaataaagtaatactatgtcacccctcaactcagtgatgattagccttgtgttcacccatacccacaatgcat 111  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |||||||    
T  36576354 gcagtaatcccatgtcacctgttatcaaaatagagtaatactatgtcacccctcaactcagtgataattagccttgtgttcacccatactcaaaatgcat 36576453  T
Q  112 ttattgttaagattttcaacgaatttgatgatatctctagatagttgcattttacagtatccgaatcagaagtgctttat 191  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||    
T  36576454 ttattgttaagattttcaacgaatttgatgatatctctagatagttgcattttatagtatccaaatcagaagtgctttat 36576533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University