View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17772_low_5 (Length: 215)

Name: NF17772_low_5
Description: NF17772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17772_low_5
NF17772_low_5
[»] chr3 (1 HSPs)
chr3 (14-197)||(43350358-43350541)


Alignment Details
Target: chr3 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 14 - 197
Target Start/End: Complemental strand, 43350541 - 43350358
Alignment:
Q  14 catagggagataaatacaacccattaggacacctcatggaaagatggttctggtagcagtaggattnnnnnnncagtgccaccaaactaaggtcagggct 113  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||| ||||||    
T  43350541 catagagagataaatacaacccattaggacacctcatggaaagatggttctggtagcagtaggattaaaaaaacagtgccaccaaactaaggttagggct 43350442  T
Q  114 tgttggttaatgactagttcagtagttgtcatatgcttttgtcnnnnnnntaaaactacctgtcatgtgcttcgttggccaaag 197  Q
    |||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||| ||||||||||    
T  43350441 tgttggttaatgactagttcagtagttgtcatatgcttttgtcaaaaaaataaaactacctgtcatgtgcttcattggccaaag 43350358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University