View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17767_low_10 (Length: 288)

Name: NF17767_low_10
Description: NF17767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17767_low_10
NF17767_low_10
[»] chr8 (2 HSPs)
chr8 (40-159)||(31927337-31927453)
chr8 (163-271)||(31927551-31927659)


Alignment Details
Target: chr8 (Bit Score: 90; Significance: 2e-43; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 40 - 159
Target Start/End: Original strand, 31927337 - 31927453
Alignment:
Q  40 gtatttgcttgaaggtgatacttaagaccaatgaaggacaacttaccagtgaaacatggcttgaaatacttaagatcaatgaagcacgtgataatatgat 139  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||   || |||||||    
T  31927337 gtatttgcttgaaggtgatacttaagaccaatgaaggacaacttaccagtggaacatgacttgaaatacttaagatcaatgaagcac---atgatatgat 31927433  T
Q  140 accgacatgagacatgacac 159  Q
    ||| ||||||||||||||||    
T  31927434 accaacatgagacatgacac 31927453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 163 - 271
Target Start/End: Original strand, 31927551 - 31927659
Alignment:
Q  163 attattaaccttatgaaagcaaagttatgggaatgataatgatccttttgaaaaagaataatgagagaannnnnnnacaatacaatccttacataaataa 262  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||       ||||| ||||| ||||||||||||    
T  31927551 attattaaccttatgaatgcaaagttatgggaatgataatgatccttttgaaaaagaataatgagagaaattttttacaatgcaatcgttacataaataa 31927650  T
Q  263 tgcgatgat 271  Q
    ||| |||||    
T  31927651 tgctatgat 31927659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University