View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17765_low_25 (Length: 214)

Name: NF17765_low_25
Description: NF17765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17765_low_25
NF17765_low_25
[»] chr3 (1 HSPs)
chr3 (16-202)||(25091067-25091251)
[»] chr5 (1 HSPs)
chr5 (118-165)||(29551550-29551597)


Alignment Details
Target: chr3 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 16 - 202
Target Start/End: Complemental strand, 25091251 - 25091067
Alignment:
Q  16 catttttcatcacaacctgtacataaaacattatgcaatggtgtaagtttaacaaacttcatatgattttgcatgattgacatgataaaaaatgcaaaca 115  Q
    ||||||||||||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  25091251 catttttcatcacaacctgtacataa--cattatgcaatggtataagtttaacaaacttcttatgattttgcatgattgacatgataaaaaatgcaaaca 25091154  T
Q  116 agtaatgcacctacattgaacttgtagtgtcgaaccatagcatccacagacaatggaagcaaacatgcaaccagcaatagtataatt 202  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  25091153 agtaatgcacctacattgaacttgtagtgtcgaaccatagcatccacagacaatggaagcaaacatgcaaccagcaatagtataatt 25091067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 118 - 165
Target Start/End: Complemental strand, 29551597 - 29551550
Alignment:
Q  118 taatgcacctacattgaacttgtagtgtcgaaccatagcatccacaga 165  Q
    |||||||| ||| |||||||||||||| |||||||| |||||||||||    
T  29551597 taatgcacgtacgttgaacttgtagtggcgaaccatggcatccacaga 29551550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University