View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17765_low_17 (Length: 249)

Name: NF17765_low_17
Description: NF17765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17765_low_17
NF17765_low_17
[»] chr1 (2 HSPs)
chr1 (32-100)||(44798533-44798601)
chr1 (171-233)||(44798400-44798462)


Alignment Details
Target: chr1 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 32 - 100
Target Start/End: Complemental strand, 44798601 - 44798533
Alignment:
Q  32 gtgttgttgttttgtgagagtaatggcagtgtctgtgtaggaagcatcaccaaagagtgtgatgttttg 100  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  44798601 gtgttgttgttttgtgagagtaatggaagtgtctgtgtaggaagcatcaccaaagagtgtgatgttttg 44798533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 44798462 - 44798400
Alignment:
Q  171 ctgagcattgtgtagaattaagagtgatgaagttttcaagaatttgttttcatggtaaagatg 233  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
T  44798462 ctgagcattgtgtagaattaagagtggtgaagttttcaagaatttgttttcatggtaaagatg 44798400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University