View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17763_low_153 (Length: 240)

Name: NF17763_low_153
Description: NF17763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17763_low_153
NF17763_low_153
[»] chr7 (1 HSPs)
chr7 (5-208)||(21930309-21930512)
[»] chr1 (1 HSPs)
chr1 (156-184)||(43168917-43168945)


Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 5 - 208
Target Start/End: Original strand, 21930309 - 21930512
Alignment:
Q  5 gagagagatgaaagtgatgtataaatagagggacagagagaaagaaacagtaaagtaatgtaaaggatgagacaaaaaggaaagagagattacaagggtt 104  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  21930309 gagagggatgaaagtgatgtataaatagagggacagagagaaagaaacagtaaagtaatgtaaaggatgagacaaaaaggaaagagagattacaagggtt 21930408  T
Q  105 agggtattgtggtgaattagataggtnnnnnnngtactatgtctcttatgttgatgttccttttagaggagcattcaagtagggtttaacagtacttcat 204  Q
    ||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  21930409 agggtattgtggtgaattagataggtaaaaaaagtactatgtctcttatgttgatgttccttttagaggagcattcaagtagggtttaacagtacttcat 21930508  T
Q  205 gcac 208  Q
    ||||    
T  21930509 gcac 21930512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 156 - 184
Target Start/End: Complemental strand, 43168945 - 43168917
Alignment:
Q  156 tgatgttccttttagaggagcattcaagt 184  Q
    |||||||||||||||||||||||||||||    
T  43168945 tgatgttccttttagaggagcattcaagt 43168917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University