View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17763_high_119 (Length: 257)

Name: NF17763_high_119
Description: NF17763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17763_high_119
NF17763_high_119
[»] chr4 (1 HSPs)
chr4 (80-242)||(34349696-34349858)


Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 80 - 242
Target Start/End: Complemental strand, 34349858 - 34349696
Alignment:
Q  80 ctactaatttgaagtttggcaaggaggtaagtactatctaacccatgattgtttcagacagaaattaaactcaggcgtttctgatcaattcgaacttaac 179  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||     
T  34349858 ctactaatttgaagtttggcaaggaggtaagtacaatctaacccatgattgtttcagacagaaattaaactcaggcatttctgatcaattcgaacttaag 34349759  T
Q  180 tgaagttcattaaccacttgagtgtccaaccaattaggttaactcaaataagtattagtttct 242  Q
    || ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
T  34349758 tgtagttcattaaccacttgagtgtccaaccaattaggttaactcaaatatgtattagtttct 34349696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University