View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17762_low_12 (Length: 229)

Name: NF17762_low_12
Description: NF17762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17762_low_12
NF17762_low_12
[»] chr4 (1 HSPs)
chr4 (107-217)||(55130141-55130251)


Alignment Details
Target: chr4 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 107 - 217
Target Start/End: Original strand, 55130141 - 55130251
Alignment:
Q  107 gtaagaatgtataaacgtgtcaaattatcccaaacatatttagtaatattattatatttttcaagttgcattcctaacataattattgatccaagtaagg 206  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  55130141 gtaagaacgtataaacgtgtcaaattatcccaaacatatttagtaatattattatatttttcaagttgcattcctaacataattattgatccaagtaagg 55130240  T
Q  207 atattgaaatt 217  Q
    || || |||||    
T  55130241 atcttaaaatt 55130251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University