View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17761_low_84 (Length: 210)

Name: NF17761_low_84
Description: NF17761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17761_low_84
NF17761_low_84
[»] chr6 (1 HSPs)
chr6 (81-201)||(31025726-31025846)


Alignment Details
Target: chr6 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 81 - 201
Target Start/End: Complemental strand, 31025846 - 31025726
Alignment:
Q  81 caaactactataaaatttcagacatgaatatctaggtcaatttttcttattaaccccaatatgtctctatgcatggttttgtatatataatttaagcatt 180  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  31025846 caaactactataaaatttcagacatgaatatctaggtcaatttttcttattaaccccaatatgtctctatgcatggttttgtatatataatttaagcatt 31025747  T
Q  181 agttgtttatcctttgctact 201  Q
    |||||||||||||||| ||||    
T  31025746 agttgtttatcctttggtact 31025726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University