View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17758_low_56 (Length: 221)

Name: NF17758_low_56
Description: NF17758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17758_low_56
NF17758_low_56
[»] chr7 (1 HSPs)
chr7 (30-203)||(658058-658230)


Alignment Details
Target: chr7 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 30 - 203
Target Start/End: Complemental strand, 658230 - 658058
Alignment:
Q  30 acccaccggcccattatatcaccgttttcgtctgaagctgtctttccacttcattcttcttcttcttcactaaatttcaccaccgaggtaaattttca-n 128  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||  |  ||||||||||||||||||||||||||||||||||||||||||      
T  658230 acccaccggcccattatatcaccgttttcgtctgaagctgtctttccactt--tcattcttcttcttcactaaatttcaccaccgaggtaaattttcatt 658133  T
Q  129 nnnnnnncttcaattcaatttgattaatttctaattagggttaattggaatttcattttcatgtctattaattga 203  Q
           |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
T  658132 tttttttcttcaattcaatttgattgatttctaattagggttaattggaatttcattttcatgtctattaattga 658058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University