View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17756_low_9 (Length: 384)

Name: NF17756_low_9
Description: NF17756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17756_low_9
NF17756_low_9
[»] chr7 (1 HSPs)
chr7 (24-228)||(6728611-6728816)


Alignment Details
Target: chr7 (Bit Score: 165; Significance: 4e-88; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 165; E-Value: 4e-88
Query Start/End: Original strand, 24 - 228
Target Start/End: Original strand, 6728611 - 6728816
Alignment:
Q  24 tcacaactattgaaaaaagttcttgtgccttatattattatatggtttccnnnnnnntttagcttggcttgctgactaggagatgactttaatttct-aa 122  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||| ||    
T  6728611 tcacaactattgaaaaaagttcttgtgccttatattattatatggtttccaaaaaaatttagcttggcttgctgactaggagatgactttaatttcttaa 6728710  T
Q  123 tttattaacaaatactcatattgctaattgttaatcctaacacttagtgcctgtaaaatagagatctcttttatacatcaactcgaatgtgattcaaacg 222  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||    
T  6728711 tttattaacaaatactcacattgctaattgttaatcctaacacttagtgcttgtaaaatagagatctcttttatacataaactcgaatgtgattcaaacg 6728810  T
Q  223 tgatta 228  Q
    ||||||    
T  6728811 tgatta 6728816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University