View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17755_low_92 (Length: 215)

Name: NF17755_low_92
Description: NF17755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17755_low_92
NF17755_low_92
[»] chr7 (1 HSPs)
chr7 (9-120)||(35420801-35420912)
[»] chr1 (1 HSPs)
chr1 (15-109)||(19988742-19988836)


Alignment Details
Target: chr7 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 9 - 120
Target Start/End: Original strand, 35420801 - 35420912
Alignment:
Q  9 gagaatcataggtagtagaagtgagtgaaacaaggtgatgagtgtcaccttttttggttggagggtgatggataagaggcattgtaagggacaaagcttt 108  Q
    ||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35420801 gagaaccataggtagtggaagtgagtgaaacaaggtgatgagtgtcaccttttttggttggagggtgatggataagaggcattgtaagggacaaagcttt 35420900  T
Q  109 tctaactggtgg 120  Q
    ||||||||||||    
T  35420901 tctaactggtgg 35420912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 15 - 109
Target Start/End: Original strand, 19988742 - 19988836
Alignment:
Q  15 cataggtagtagaagtgagtgaaacaaggtgatgagtgtcaccttttttggttggagggtgatggataagaggcattgtaagggacaaagctttt 109  Q
    ||||||| || || ||||| ||||||||||||||||| ||||||||| | |||||||||||||| | |||||||||||  || |||| |||||||    
T  19988742 cataggtggtggaggtgagggaaacaaggtgatgagtatcaccttttcttgttggagggtgatgcacaagaggcattgggagagacatagctttt 19988836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University