View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17755_high_49 (Length: 268)

Name: NF17755_high_49
Description: NF17755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17755_high_49
NF17755_high_49
[»] chr1 (1 HSPs)
chr1 (20-257)||(32931325-32931563)
[»] chr3 (5 HSPs)
chr3 (110-217)||(21215796-21215901)
chr3 (99-206)||(32152860-32152968)
chr3 (104-219)||(36564970-36565083)
chr3 (104-219)||(36543240-36543353)
chr3 (111-206)||(19534069-19534165)


Alignment Details
Target: chr1 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 20 - 257
Target Start/End: Complemental strand, 32931563 - 32931325
Alignment:
Q  20 gaacggaatagcataatttttaaaaataagacaactttatcccatctgtttatggataaaattaagctgcnnnnnnncgg-tggctgaaaacaaaatatg 118  Q
    |||| |||||||| ||||||||||||||||||||||| || ||||| | ||||||||||||||||||||        | | || ||||||| ||||||||    
T  32931563 gaacagaatagcagaatttttaaaaataagacaacttcattccatccgcttatggataaaattaagctgttttttttccgatgcctgaaaataaaatatg 32931464  T
Q  119 ttatttttgtttttgactattatagttggtggcttattccttttgtttgtattgccattggttaatttttccttttgtgtttcttgtcggtctctttatc 218  Q
    |||||||| ||||||| ||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||    
T  32931463 ttatttttatttttgattatcatagttggtggcttattccttttgtttgtcttgccattggttaatttttccttttgtgtttattgtcggtctctttatc 32931364  T
Q  219 ccgttgctagtgttgtctacactttagtgttcttctctg 257  Q
    |||||||||||||||||||||||||| ||||||||||||    
T  32931363 ccgttgctagtgttgtctacactttattgttcttctctg 32931325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 53; Significance: 2e-21; HSPs: 5)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 110 - 217
Target Start/End: Complemental strand, 21215901 - 21215796
Alignment:
Q  110 caaaatatgttatttttgtttttgactattatagttggtggcttattccttttgtttgtattgccattggttaatttttccttttgtgtttcttgtcggt 209  Q
    |||||||||||| ||||| ||||| |||| ||||||||||| ||  ||||||||||||| ||| ||||| |||||||||||  |||||||| ||||||||    
T  21215901 caaaatatgttaattttgcttttggctatcatagttggtggatttctccttttgtttgttttggcattgattaatttttcc--ttgtgttttttgtcggt 21215804  T
Q  210 ctctttat 217  Q
    ||||||||    
T  21215803 ctctttat 21215796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 99 - 206
Target Start/End: Complemental strand, 32152968 - 32152860
Alignment:
Q  99 gtggctgaaaacaaaatatgttatttttgtttttgactattatagttggtggcttattccttttgtttgtattgccattggttaattt-ttccttttgtg 197  Q
    ||||||||| |||||||||| || | ||| |||||| |||  |||||||||||||  ||||||||||||| | ||||| |||||||||  ||||||||||    
T  32152968 gtggctgaagacaaaatatgctaatattgcttttgattatcgtagttggtggctttgtccttttgtttgtttggccatgggttaatttactccttttgtg 32152869  T
Q  198 tttcttgtc 206  Q
    ||| |||||    
T  32152868 ttttttgtc 32152860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 219
Target Start/End: Original strand, 36564970 - 36565083
Alignment:
Q  104 tgaaaacaaaatatgttatttttgtttttgactattatagttggtggcttattccttttgtttgtattgccattggttaatttttccttttgtgtttctt 203  Q
    ||||||||||||||||||  |||| ||||   ||| ||||||| ||||||  ||||||||||||| |||  ||||||||||||||  | |||||||| ||    
T  36564970 tgaaaacaaaatatgttaactttgctttttgttatcatagttgatggctttctccttttgtttgtcttgaaattggttaattttt--tcttgtgtttttt 36565067  T
Q  204 gtcggtctctttatcc 219  Q
    | ||||||||||||||    
T  36565068 gccggtctctttatcc 36565083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 36543353 - 36543240
Alignment:
Q  104 tgaaaacaaaatatgttatttttgtttttgactattatagttggtggcttattccttttgtttgtattgccattggttaatttttccttttgtgtttctt 203  Q
    ||||||||||| ||||||  |||| ||||   ||| ||||||| ||||||  ||||||||||||| |||  ||||||||||||||  | |||||||| ||    
T  36543353 tgaaaacaaaacatgttaactttgctttttgttatcatagttgatggctttctccttttgtttgtcttgaaattggttaattttt--tcttgtgtttttt 36543256  T
Q  204 gtcggtctctttatcc 219  Q
    | ||||||||||||||    
T  36543255 gccggtctctttatcc 36543240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 111 - 206
Target Start/End: Original strand, 19534069 - 19534165
Alignment:
Q  111 aaaatatgttatttttgtttttgactattatagttggtggcttattccttttgtttgtattgccattggttaattt-ttccttttgtgtttcttgtc 206  Q
    ||||||||||| | |||||||||| |||| |||||  ||||||  ||||||||||||| | | ||| ||| ||||| |||||||||||||| |||||    
T  19534069 aaaatatgttaatattgtttttgattattgtagttaatggctttgtccttttgtttgtttggacataggtaaatttattccttttgtgttttttgtc 19534165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University