View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17754_high_17 (Length: 293)

Name: NF17754_high_17
Description: NF17754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17754_high_17
NF17754_high_17
[»] chr4 (1 HSPs)
chr4 (13-277)||(55076608-55076872)
[»] chr6 (1 HSPs)
chr6 (13-146)||(15125312-15125445)
[»] chr1 (1 HSPs)
chr1 (109-191)||(43665606-43665688)


Alignment Details
Target: chr4 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 13 - 277
Target Start/End: Original strand, 55076608 - 55076872
Alignment:
Q  13 aatatgcttcaaggaccatgtcgtgccttccttggtgaccttgctgccggtgatcaccgtcgaatgagaatgggcaatgccatgttctctttcttcatgg 112  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  55076608 aatatgcttcaaggaccctgtcgtgccttccttggtgaccttgctgccggtgatcaccgtagaatgagaatgggcaatgccatgttctctttcttcatgg 55076707  T
Q  113 ccgtgggaaatatccttggttatgccgccggctctttcagcaaactctatcacatgtttcctttcacccaaactaaagcttgcgatgtcttttgcgctaa 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  55076708 ccgtgggaaatatccttggttatgccgccggctctttcagcaaactctatcacatgtttcctttcacccaaactaaagcttgcgatgtcttttgcgctaa 55076807  T
Q  213 tctcaaaacatgtttcttcttatcaatattccttctcgctctcgtttcttcctttgctctatatt 277  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  55076808 tctcaaaacatgtttcttcttatcaatattccttctcgctctcgtttcttcctttgctctatatt 55076872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 13 - 146
Target Start/End: Complemental strand, 15125445 - 15125312
Alignment:
Q  13 aatatgcttcaaggaccatgtcgtgccttccttggtgaccttgctgccggtgatcaccgtcgaatgagaatgggcaatgccatgttctctttcttcatgg 112  Q
    ||||||||||||||||| |||||||||||| |||||||||| ||||  ||||||||||||||||||||||| |||||||  ||||||||||| |||||||    
T  15125445 aatatgcttcaaggaccttgtcgtgccttcattggtgacctcgctggtggtgatcaccgtcgaatgagaattggcaatgggatgttctcttttttcatgg 15125346  T
Q  113 ccgtgggaaatatccttggttatgccgccggctc 146  Q
    |||| || ||| ||||||||||||| || |||||    
T  15125345 ccgtcggtaatgtccttggttatgctgctggctc 15125312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 109 - 191
Target Start/End: Complemental strand, 43665688 - 43665606
Alignment:
Q  109 atggccgtgggaaatatccttggttatgccgccggctctttcagcaaactctatcacatgtttcctttcacccaaactaaagc 191  Q
    |||||||| || || ||||| ||||| ||||||||  ||| ||||||||||| |||| ||||||| |||||| |||| |||||    
T  43665688 atggccgtcggtaacatcctcggttacgccgccggtgcttacagcaaactctttcacgtgtttccgttcaccaaaacaaaagc 43665606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University