View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17753_low_8 (Length: 283)

Name: NF17753_low_8
Description: NF17753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17753_low_8
NF17753_low_8
[»] chr5 (2 HSPs)
chr5 (13-267)||(34391078-34391332)
chr5 (30-67)||(39975852-39975889)


Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 13 - 267
Target Start/End: Complemental strand, 34391332 - 34391078
Alignment:
Q  13 aaaatatgagttatccaaaggagatttagttgtttgtccagaaggaacaacatgtcgcgagcctttccttttacgatttagtgctctatttgccgagcta 112  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34391332 aaaatatgagttatccaaaggagatttagttgtctgtccagaaggaacaacatgtcgcgagcctttccttttacgatttagtgctctatttgccgagcta 34391233  T
Q  113 actgaccggatagtaccggtcgccatgaactatagagtagggttcttccatgcaacaactgcaaggggatggaagggtttggacccggttttcttcttca 212  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||||||||||||||    
T  34391232 actgaccggatagtaccggtcgccatgaactatagagtagggttcttccatgcaaccactgcaaggggttggaaaggtttggacccggttttcttcttca 34391133  T
Q  213 tgaacccaagaccagtttatgaggttactttcttgaaccagttgccggttgaagc 267  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
T  34391132 tgaacccaagaccagtttatgaggttacattcttgaaccagttgccggttgaagc 34391078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 67
Target Start/End: Complemental strand, 39975889 - 39975852
Alignment:
Q  30 aaggagatttagttgtttgtccagaaggaacaacatgt 67  Q
    |||| ||||||||||||||||| |||||||||||||||    
T  39975889 aaggtgatttagttgtttgtcctgaaggaacaacatgt 39975852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University