View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17751_low_13 (Length: 266)

Name: NF17751_low_13
Description: NF17751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17751_low_13
NF17751_low_13
[»] chr4 (1 HSPs)
chr4 (129-254)||(39292080-39292209)


Alignment Details
Target: chr4 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 129 - 254
Target Start/End: Complemental strand, 39292209 - 39292080
Alignment:
Q  129 taatgttttaaatgaatctcaattactcaaatcttgaaagtttacacataaagatgtattaattaattaat----gacatacacgattgatgttgtaaaa 224  Q
    ||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||    |||||||||||||||||||||||||    
T  39292209 taatgttttaaatgaatctcaattactcatatcttcaaagtttacacataaagatgtattaattaattaattaatgacatacacgattgatgttgtaaaa 39292110  T
Q  225 caggtatatgatggctacacccggtgatga 254  Q
    ||||||||||||||||||||||||||||||    
T  39292109 caggtatatgatggctacacccggtgatga 39292080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University