View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1774_low_7 (Length: 258)

Name: NF1774_low_7
Description: NF1774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1774_low_7
NF1774_low_7
[»] chr1 (1 HSPs)
chr1 (11-249)||(25895518-25895757)


Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 11 - 249
Target Start/End: Complemental strand, 25895757 - 25895518
Alignment:
Q  11 atgagtattaactggtggtggaggtgtggggggagcagaagtagtaaggggcagggatgcattgggtgaagttaagtgggtggcagaaaaggaaataggt 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
T  25895757 atgagtattaactggtggtggaggtgtggggggagcagaagtagtaaggggcagggatgcattgggtgaagttaagtgggtggcagaaaaggaaatatgt 25895658  T
Q  111 gtagatgtgggttgatttattgaggaagttgtggaaggaagtggattt-tagaagaggacagatgatgggttgattgagagttgggagatgggaaattct 209  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  25895657 gtagatgtgggttgatttatagaggaagttgtggaaggaagtggatttgtagaagaggacagatgatgggttgattgagagttgggagatgggaaattct 25895558  T
Q  210 gatctgtaggggaagttataggaggggcaggtgatgatgt 249  Q
    |||||||||||||||||||||||||||||| |||||||||    
T  25895557 gatctgtaggggaagttataggaggggcagctgatgatgt 25895518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University