View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17743_low_58 (Length: 204)

Name: NF17743_low_58
Description: NF17743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17743_low_58
NF17743_low_58
[»] scaffold0175 (1 HSPs)
scaffold0175 (47-162)||(29790-29905)
[»] chr4 (1 HSPs)
chr4 (77-167)||(1221343-1221433)


Alignment Details
Target: scaffold0175 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: scaffold0175
Description:

Target: scaffold0175; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 47 - 162
Target Start/End: Original strand, 29790 - 29905
Alignment:
Q  47 ccatctttaatattgagacttgtcaatgactcaagactgtcaaagtatggataatcaagtgctgttttggcatatattctctcagcaggattgtacttga 146  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| |||||    
T  29790 ccatcattaatattgagacttgtcaatgactcaagactgtcaaagtatggatgatcaagtgctgttttggcatatattctctcagcatgattgtgcttga 29889  T
Q  147 gcattttctgcaggta 162  Q
    ||||||||||||||||    
T  29890 gcattttctgcaggta 29905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 79; Significance: 4e-37; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 77 - 167
Target Start/End: Original strand, 1221343 - 1221433
Alignment:
Q  77 tcaagactgtcaaagtatggataatcaagtgctgttttggcatatattctctcagcaggattgtacttgagcattttctgcaggtacataa 167  Q
    |||||||||||||||||||||| ||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
T  1221343 tcaagactgtcaaagtatggatgatcaagtgctgctttggcagatattctctcagcaggattgtacttgagcattttctgcaggtacataa 1221433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University