View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17742_low_69 (Length: 231)

Name: NF17742_low_69
Description: NF17742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17742_low_69
NF17742_low_69
[»] chr6 (1 HSPs)
chr6 (19-122)||(31788511-31788613)


Alignment Details
Target: chr6 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 19 - 122
Target Start/End: Original strand, 31788511 - 31788613
Alignment:
Q  19 tgggtttccatattcatcaaccctacgtgtttgatcaccataaccttgttgatattgagacattgttataatttcttcttcacaaacaaaaaataacgtg 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
T  31788511 tgggtttccatattcatcaaccctacgtgtttgatcaccataaccttgttgatattgagacattgttataa-ttcttcttcacaaacaaaaaataacgtg 31788609  T
Q  119 aagt 122  Q
    ||||    
T  31788610 aagt 31788613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University