View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17742_low_56 (Length: 256)

Name: NF17742_low_56
Description: NF17742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17742_low_56
NF17742_low_56
[»] chr2 (2 HSPs)
chr2 (11-123)||(8931612-8931724)
chr2 (209-256)||(8931479-8931526)


Alignment Details
Target: chr2 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 11 - 123
Target Start/End: Complemental strand, 8931724 - 8931612
Alignment:
Q  11 tttaagttgtgttgcatgctgataaagcttaagcaggagaaatgcaacagcaagccttgtagagtaccttagtgctgaatcgctttctcatctcaaaagc 110  Q
    |||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  8931724 tttaagttgtcttgtatgctgataaagcttaagcaggagaaatgcaacagcaagccttgtagagtaccttagtgctgaatcgctttctcatctcaaaagc 8931625  T
Q  111 tggcgtgccatcc 123  Q
    |||||||||||||    
T  8931624 tggcgtgccatcc 8931612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 209 - 256
Target Start/End: Complemental strand, 8931526 - 8931479
Alignment:
Q  209 ggaatgaattgtttctctcgttgagtggagaagcatttagtatgatga 256  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
T  8931526 ggaatgaattgtttctctcgttgagtggagaagcatttagtatgatga 8931479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University