View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1773_low_151 (Length: 239)

Name: NF1773_low_151
Description: NF1773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1773_low_151
NF1773_low_151
[»] chr4 (1 HSPs)
chr4 (94-223)||(32803996-32804125)
[»] chr1 (1 HSPs)
chr1 (94-223)||(49028810-49028939)


Alignment Details
Target: chr4 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 94 - 223
Target Start/End: Complemental strand, 32804125 - 32803996
Alignment:
Q  94 caccatcttcgctccctccgattcagcgttcaagaaatctggtcaaccaccactcgatcttcttctctttcacttcgtcatgttaccgctcccgcagcaa 193  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||    
T  32804125 caccatcttcgctccctccgattcagcgttcaagaaatctggtcaaccatcactcgatcttcttctctttcacttcgtcatcttaccgctcccgcagcaa 32804026  T
Q  194 agcctccggcgtcttcccgctggcactaag 223  Q
    ||||||||||||||||||||||||||||||    
T  32804025 agcctccggcgtcttcccgctggcactaag 32803996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 94 - 223
Target Start/End: Complemental strand, 49028939 - 49028810
Alignment:
Q  94 caccatcttcgctccctccgattcagcgttcaagaaatctggtcaaccaccactcgatcttcttctctttcacttcgtcatgttaccgctcccgcagcaa 193  Q
    |||| |||| |||||||||||||| |||||||||||||| ||||||||  |||||||||||||||  || |||||||||||||||||||| |||||||||    
T  49028939 caccgtctttgctccctccgattccgcgttcaagaaatccggtcaaccttcactcgatcttcttcgtttccacttcgtcatgttaccgcttccgcagcaa 49028840  T
Q  194 agcctccggcgtcttcccgctggcactaag 223  Q
    ||| | || ||||||||||| ||| |||||    
T  49028839 agcttacgccgtcttcccgccggcgctaag 49028810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University