View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1773_low_149 (Length: 244)

Name: NF1773_low_149
Description: NF1773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1773_low_149
NF1773_low_149
[»] chr1 (2 HSPs)
chr1 (63-244)||(51407072-51407253)
chr1 (183-219)||(51756353-51756388)


Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 63 - 244
Target Start/End: Complemental strand, 51407253 - 51407072
Alignment:
Q  63 ccctgttttggtgaccagtgactttatagttaggttgtagctgcaacctcaatatgctaattttatggttcttttgatttttggtgtctttgtggattat 162  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  51407253 ccctgttttggtgaccagtgactttatagttaggttgtagctgcaacctcaatatgctaattttatggttcttttgatttttggtgtctttgtggattat 51407154  T
Q  163 tgttaatttacagcttaaccaattgctatgttattttcattttatttgttagttagaattattgcttatttacagaacagtt 244  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  51407153 tgttaatttacagcttaaccaattgctctgttattttcattttatttgttagttagaattattgcttatttacagaacagtt 51407072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 183 - 219
Target Start/End: Complemental strand, 51756388 - 51756353
Alignment:
Q  183 aattgctatgttattttcattttatttgttagttaga 219  Q
    ||||||||||||||||||| |||||||||||||||||    
T  51756388 aattgctatgttattttca-tttatttgttagttaga 51756353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University